Unikmer Save

a versatile toolkit for k-mers with taxonomic information

Project README

unikmer: a versatile toolkit for k-mers with taxonomic information

Documents: https://bioinf.shenwei.me/unikmer/

unikmer is a toolkit for nucleic acid k-mer analysis, providing functions including set operation k-mers (sketch) optional with TaxIds but without count information.

K-mers are either encoded (k<=32) or hashed (k<=64, using ntHash v1) into uint64, and serialized in binary file with extension .unik.

TaxIds can be assigned when counting k-mers from genome sequences, and LCA (Lowest Common Ancestor) is computed during set opertions including computing union, intersecton, set difference, unique and repeated k-mers.

Related projects:

kmers provides bit-packed k-mers methods for this tool.
unik provides k-mer serialization methods for this tool.
sketches provides generators/iterators for k-mer sketches (Minimizer, Scaled MinHash, Closed Syncmers).
taxdump provides querying manipulations from NCBI Taxonomy taxdump files.

Using cases
Installation
Commands
Binary file
Quick start
Support
License

Using cases

Finding conserved regions in all genomes of a species.
Finding species/strain-specific sequences for designing probes/primers.

Installation

Downloading executable binary files.
Via Bioconda
```
 conda install -c bioconda unikmer
```

Commands

Usages

Counting

 count           Generate k-mers (sketch) from FASTA/Q sequences

Information

 info            Information of binary files
 num             Quickly inspect the number of k-mers in binary files

Format conversion

 view            Read and output binary format to plain text
 dump            Convert plain k-mer text to binary format

 encode          Encode plain k-mer texts to integers
 decode          Decode encoded integers to k-mer texts

Set operations

 concat          Concatenate multiple binary files without removing duplicates
 inter           Intersection of k-mers in multiple binary files
 common          Find k-mers shared by most of the binary files
 union           Union of k-mers in multiple binary files
 diff            Set difference of k-mers in multiple binary files

Split and merge

 sort            Sort k-mers to reduce the file size and accelerate downstream analysis
 split           Split k-mers into sorted chunk files
 tsplit          Split k-mers according to TaxId
 merge           Merge k-mers from sorted chunk files

Subset

 head            Extract the first N k-mers
 sample          Sample k-mers from binary files
 grep            Search k-mers from binary files
 filter          Filter out low-complexity k-mers
 rfilter         Filter k-mers by taxonomic rank

Searching on genomes

 locate          Locate k-mers in genome
 map             Mapping k-mers back to the genome and extract successive regions/subsequences

Misc

 autocompletion  Generate shell autocompletion script
 version         Print version information and check for update

Binary file

K-mers (represented in uint64 in RAM ) are serialized in 8-Byte (or less Bytes for shorter k-mers in compact format, or much less Bytes for sorted k-mers) arrays and optionally compressed in gzip format with extension of .unik. TaxIds are optionally stored next to k-mers with 4 or less bytes.

Compression ratio comparison

No TaxIds stored in this test.

label	encoded-kmer^a	gzip-compressed^b	compact-format^c	sorted^d	comment
`plain`					plain text
`gzip`		✔			gzipped plain text
`unik.default`	✔	✔			gzipped encoded k-mers in fixed-length byte array
`unik.compat`	✔	✔	✔		gzipped encoded k-mers in shorter fixed-length byte array
`unik.sorted`	✔	✔		✔	gzipped sorted encoded k-mers

^a One k-mer is encoded as uint64 and serialized in 8 Bytes.
^b K-mers file is compressed in gzip format by default, users can switch on global option -C/--no-compress to output non-compressed file.
^c One k-mer is encoded as uint64 and serialized in 8 Bytes by default. However few Bytes are needed for short k-mers, e.g., 4 Bytes are enough for 15-mers (30 bits). This makes the file more compact with smaller file size, controled by global option -c/--compact .
^d One k-mer is encoded as uint64, all k-mers are sorted and compressed using varint-GB algorithm.
In all test, flag --canonical is ON when running unikmer count.

Quick Start

# memusg is for compute time and RAM usage: https://github.com/shenwei356/memusg


# counting (only keep the canonical k-mers and compact output)
# memusg -t unikmer count -k 23 Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta.gz.k23 --canonical --compact
$ memusg -t unikmer count -k 23 Ecoli-MG1655.fasta.gz -o Ecoli-MG1655.fasta.gz.k23 --canonical --compact
elapsed time: 0.897s
peak rss: 192.41 MB


# counting (only keep the canonical k-mers and sort k-mers)
# memusg -t unikmer count -k 23 Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta.gz.k23.sorted --canonical --sort
$ memusg -t unikmer count -k 23 Ecoli-MG1655.fasta.gz -o Ecoli-MG1655.fasta.gz.k23.sorted --canonical --sort
elapsed time: 1.136s
peak rss: 227.28 MB


# counting and assigning global TaxIds
$ unikmer count -k 23 -K -s Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta.gz.k23.sorted   -t 585057
$ unikmer count -k 23 -K -s Ecoli-MG1655.fasta.gz -o Ecoli-MG1655.fasta.gz.k23.sorted -t 511145
$ unikmer count -k 23 -K -s A.muciniphila-ATCC_BAA-835.fasta.gz -o A.muciniphila-ATCC_BAA-835.fasta.gz.sorted -t 349741

# counting minimizer and ouputting in linear order
$ unikmer count -k 23 -W 5 -H -K -l A.muciniphila-ATCC_BAA-835.fasta.gz -o A.muciniphila-ATCC_BAA-835.fasta.gz.m

# view
$ unikmer view Ecoli-MG1655.fasta.gz.k23.sorted.unik --show-taxid | head -n 3
AAAAAAAAACCATCCAAATCTGG 511145
AAAAAAAAACCGCTAGTATATTC 511145
AAAAAAAAACCTGAAAAAAACGG 511145

# view (hashed k-mers needs original FASTA/Q file)
$ unikmer view --show-code --genome A.muciniphila-ATCC_BAA-835.fasta.gz A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik | head -n 3
CATCCGCCATCTTTGGGGTGTCG 1210726578792
AGCGCAAAATCCCCAAACATGTA 2286899379883
AACTGATTTTTGATGATGACTCC 3542156397282

# find the positions of k-mers
$ unikmer locate -g A.muciniphila-ATCC_BAA-835.fasta.gz A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik | head -n 5
NC_010655.1     2       25      ATCTTATAAAATAACCACATAAC 0       .
NC_010655.1     5       28      TTATAAAATAACCACATAACTTA 0       .
NC_010655.1     6       29      TATAAAATAACCACATAACTTAA 0       .
NC_010655.1     9       32      AAAATAACCACATAACTTAAAAA 0       .
NC_010655.1     13      36      TAACCACATAACTTAAAAAGAAT 0       .

# info
$ unikmer info *.unik -a -j 10
file                                              k  canonical  hashed  scaled  include-taxid  global-taxid  sorted  compact  gzipped  version     number  description
A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik       23  ✓          ✓       ✕       ✕                            ✕       ✕        ✓        v5.0       860,900             
A.muciniphila-ATCC_BAA-835.fasta.gz.sorted.unik  23  ✓          ✕       ✕       ✕                    349741  ✓       ✕        ✓        v5.0     2,630,905             
Ecoli-IAI39.fasta.gz.k23.sorted.unik             23  ✓          ✕       ✕       ✕                    585057  ✓       ✕        ✓        v5.0     4,902,266             
Ecoli-IAI39.fasta.gz.k23.unik                    23  ✓          ✕       ✕       ✕                            ✕       ✓        ✓        v5.0     4,902,266             
Ecoli-MG1655.fasta.gz.k23.sorted.unik            23  ✓          ✕       ✕       ✕                    511145  ✓       ✕        ✓        v5.0     4,546,632             
Ecoli-MG1655.fasta.gz.k23.unik                   23  ✓          ✕       ✕       ✕                            ✕       ✓        ✓        v5.0     4,546,632             


# concat
$ memusg -t unikmer concat *.k23.sorted.unik -o concat.k23 -c
elapsed time: 1.020s
peak rss: 25.86 MB



# union
$ memusg -t unikmer union *.k23.sorted.unik -o union.k23 -s
elapsed time: 3.991s
peak rss: 590.92 MB


# or sorting with limited memory.
# note that taxonomy database need some memory.
$ memusg -t unikmer sort *.k23.sorted.unik -o union2.k23 -u -m 1M
elapsed time: 3.538s
peak rss: 324.2 MB

$ unikmer view -t union.k23.unik | md5sum 
4c038832209278840d4d75944b29219c  -
$ unikmer view -t union2.k23.unik | md5sum 
4c038832209278840d4d75944b29219c  -


# duplicate k-mers
# memusg -t unikmer sort *.k23.sorted.unik -o dup.k23 -d -m 1M # limit memory usage
$ memusg -t unikmer sort *.k23.sorted.unik -o dup.k23 -d
elapsed time: 1.143s
peak rss: 240.18 MB


# intersection
$ memusg -t unikmer inter *.k23.sorted.unik -o inter.k23
elapsed time: 1.481s
peak rss: 399.94 MB


# difference
$ memusg -t unikmer diff -j 10 *.k23.sorted.unik -o diff.k23 -s
elapsed time: 0.793s
peak rss: 338.06 MB


$ ls -lh *.unik
-rw-r--r-- 1 shenwei shenwei 6.6M Sep  9 17:24 A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik
-rw-r--r-- 1 shenwei shenwei 9.5M Sep  9 17:24 A.muciniphila-ATCC_BAA-835.fasta.gz.sorted.unik
-rw-r--r-- 1 shenwei shenwei  46M Sep  9 17:25 concat.k23.unik
-rw-r--r-- 1 shenwei shenwei 9.2M Sep  9 17:27 diff.k23.unik
-rw-r--r-- 1 shenwei shenwei  11M Sep  9 17:26 dup.k23.unik
-rw-r--r-- 1 shenwei shenwei  18M Sep  9 17:23 Ecoli-IAI39.fasta.gz.k23.sorted.unik
-rw-r--r-- 1 shenwei shenwei  29M Sep  9 17:24 Ecoli-IAI39.fasta.gz.k23.unik
-rw-r--r-- 1 shenwei shenwei  17M Sep  9 17:23 Ecoli-MG1655.fasta.gz.k23.sorted.unik
-rw-r--r-- 1 shenwei shenwei  27M Sep  9 17:25 Ecoli-MG1655.fasta.gz.k23.unik
-rw-r--r-- 1 shenwei shenwei  11M Sep  9 17:27 inter.k23.unik
-rw-r--r-- 1 shenwei shenwei  26M Sep  9 17:26 union2.k23.unik
-rw-r--r-- 1 shenwei shenwei  26M Sep  9 17:25 union.k23.unik

$ unikmer stats *.unik -a -j 10
file                                              k  canonical  hashed  scaled  include-taxid  global-taxid  sorted  compact  gzipped  version     number  description
A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik       23  ✓          ✓       ✕       ✕                            ✕       ✕        ✓        v5.0       860,900             
A.muciniphila-ATCC_BAA-835.fasta.gz.sorted.unik  23  ✓          ✕       ✕       ✕                    349741  ✓       ✕        ✓        v5.0     2,630,905             
concat.k23.unik                                  23  ✓          ✕       ✕       ✓                            ✕       ✓        ✓        v5.0            -1             
diff.k23.unik                                    23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     2,326,096             
dup.k23.unik                                     23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     2,576,170             
Ecoli-IAI39.fasta.gz.k23.sorted.unik             23  ✓          ✕       ✕       ✕                    585057  ✓       ✕        ✓        v5.0     4,902,266             
Ecoli-IAI39.fasta.gz.k23.unik                    23  ✓          ✕       ✕       ✕                            ✕       ✓        ✓        v5.0     4,902,266             
Ecoli-MG1655.fasta.gz.k23.sorted.unik            23  ✓          ✕       ✕       ✕                    511145  ✓       ✕        ✓        v5.0     4,546,632             
Ecoli-MG1655.fasta.gz.k23.unik                   23  ✓          ✕       ✕       ✕                            ✕       ✓        ✓        v5.0     4,546,632             
inter.k23.unik                                   23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     2,576,170             
union2.k23.unik                                  23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     6,872,728             
union.k23.unik                                   23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     6,872,728

# -----------------------------------------------------------------------------------------

# mapping k-mers to genome
seqkit seq Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta
g=Ecoli-IAI39.fasta
f=inter.k23.unik
# mapping k-mers back to the genome and extract successive regions/subsequences
unikmer map -g $g $f -a | more


# using bwa
# to fasta
unikmer view $f -a -o $f.fa.gz
# make index
bwa index $g; samtools faidx $g
ncpu=12
ls $f.fa.gz \
    | rush -j 1 -v ref=$g -v j=$ncpu \
        'bwa aln -o 0 -l 17 -k 0 -t {j} {ref} {} \
            | bwa samse {ref} - {} \
            | samtools view -bS > {}.bam; \
         samtools sort -T {}.tmp -@ {j} {}.bam -o {}.sorted.bam; \
         samtools index {}.sorted.bam; \
         samtools flagstat {}.sorted.bam > {}.sorted.bam.flagstat; \
         /bin/rm {}.bam '

Support

Please open an issue to report bugs, propose new functions or ask for help.

License

MIT License

Open Source Agenda is not affiliated with "Unikmer" Project. README Source: shenwei356/unikmer

Stars

Open Issues

Last Commit

5 months ago

Repository

shenwei356/unikmer

License

MIT

Homepage

https://bioinf.shenwei.me/unikmer

Open Source Agenda Badge

<a href="https://www.opensourceagenda.com/projects/unikmer"><img src="https://www.opensourceagenda.com/projects/unikmer/reviews/badge.svg" alt="Open Source Agenda"></a>

Submit Review Review Your Favorite Project

Submit Resource Articles, Courses, Videos

Submit Article Submit a post to our blog