Fast hash function for DNA/RNA sequences
ntHash is an efficient rolling hash function for k-mers and spaced seeds.
Make sure Meson is installed on the system.
Download the repo (either from the releases section or close using git clone https://github.com/bcgsc/ntHash
). Setup meson in an arbitrary directory (e.g. build
), by running the following command in the project's root (include --prefix=PREFIX
set the installation prefix to PREFIX
):
meson setup --buildtype=release --prefix=PREFIX build
Then, install the project and its dependencies using:
meson install -C build
This will install include/nthash
and lib/libnthash.a
to the installation prefix.
To use ntHash in a C++ project:
#include <nthash/nthash.hpp>
nthash
namespaceinclude
directory (pass -IPREFIX/include
to the compiler)libnthash.a
(i.e. pass -LPREFIX/lib -lnthash
to the compiler, where PREFIX
is the installation prefix)-std=c++17
(and preferably -O3
) enabledRefer to docs for more information.
Generally, the nthash::NtHash
and nthash::SeedNtHash
classes are used for hashing sequences:
nthash::NtHash nth("TGACTGATCGAGTCGTACTAG", 1, 5); // 1 hash per 5-mer
while (nth.roll()) {
// use nth.hashes() for canonical hashes
// nth.get_forward_hash() for forward strand hashes
// nth.get_reverse_hash() for reverse strand hashes
}
std::vector<std::string> seeds = {"10101", "11011"};
nthash::SeedNtHash nth("TGACTGATCGAGTCGTACTAG", seeds, 3, 5);
while (nth.roll()) {
// nth.hashes()[0] = "T#A#T"'s first hash
// nth.hashes()[1] = "T#A#T"'s second hash
// nth.hashes()[2] = "T#A#T"'s third hash
// nth.hashes()[3] = "TG#CT"'s first hash
}
If you would like to contribute to the development of ntHash, after forking/cloning the repo, create the build
directory without the release flag:
meson setup build
Compile the code, tests, and benchmarking script using:
meson compile -C build
If compilation is successful, libnthash.a
will be available in the build
folder. The benchmarking script is also compiled as the bench
binary file in build
.
Before sending a PR, make sure that:
meson test
in the project directoryninja clang-format
in the build
folder (requires clang-format
to be available)ninja clang-tidy-check
in build
returns no errors (requires clang-tools
to be installed)ninja docs
in build
(requires doxygen)Parham Kazemi, Johnathan Wong, Vladimir Nikolić, Hamid Mohamadi, René L Warren, Inanç Birol, ntHash2: recursive spaced seed hashing for nucleotide sequences, Bioinformatics, 2022;, btac564, https://doi.org/10.1093/bioinformatics/btac564
Hamid Mohamadi, Justin Chu, Benjamin P Vandervalk, and Inanc Birol. ntHash: recursive nucleotide hashing. Bioinformatics (2016) 32 (22): 3492-3494. doi:10.1093/bioinformatics/btw397